Research Article

Molecular Characterization and Bioinformatics Analysis of Virb11 in Vibrio Harveyi  

Denicia  Atujona , Weijian  Liang , Shuanghu  Cai , huanying pang , Umar Faruk  Mustapha , Michael Essien  Sekyi , Emmanuel. D.  Abarike
1 College of Fisheries, Guangdong Ocean University, Zhanjiang 524025, China
2 Guangdong Provincial Key Laboratory of Aquaculture in the South China Sea for Aquatic Economic Animals, Zhanjiang 524025, China
3 Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Zhanjiang 524025, China
4 Department of Fisheries and Aquatic Resources Management, University for Development Studies, Tamale-Ghana

Author    Correspondence author
Genomics and Applied Biology, 2018, Vol. 9, No. 8   doi: 10.5376/gab.2018.09.0008
Received: 17 Aug., 2018    Accepted: 25 Aug., 2018    Published: 10 Sep., 2018
© 2018 BioPublisher Publishing Platform
This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article:

 Atujona D., Liang W.J.,Cai S.H., Pang H.Y., Mustapha U.F., Sakyi E. M., and Abarike E.D., 2018, Molecular characterization and bioinformatics analysis of Virb11 in Vibrio harveyi, Genomics and Applied Biology, 9(8): 48-55 (doi: 10.5376/gab.2018.09.0008)

Abstract

Vibrio harveyi has caused devastating loses in mariculture through vibrioses infection. VirB11 plays a critical role in bacteria substrate translocation and virulence. The present study is a bioinformatic analysis of VirB11 in Vibrio harveyi. VirB11 was cloned and analyzed, unveiling an encoded nucleotide sequence of 1,034 bp coding 338 amino acids. A molecular weight and pI of 37,703.39 Da and 6.31 were respectively predicted. No signal peptides and transmembranes were predicted. A conserved P-loop NTPase was predicted, multiple predictions also included 3D module.

Keywords
Vibrio harveyi; VirB11; Bioinformatic analysis

Background

Aquaculture in the last fifty years has experienced tremendous growth globally from a production of less than a million tons in the early 1950s to over 50 million tons in the year 2008 (FAO, 2009). Aquaculture has become an economic activity of great importance worldwide due to overfishing of wild populations (Cruz et al., 2012). Asia, since 2008 produced more farmed fish in meeting rising fish food demand (FAO, 2014); this has however been faced with drastic challenges of diseases due to stretches in management practices. Environmental parameters including pH, temperature and salinity affects immune responses in crustaceans and vertebrates, suscepting them to diseases (Cheng and Chen, 2000).

 

Diseases confronting aquaculture range from bacterial to viral. This study characterizes the molecular and bioinformatics analysis of VirB11 protein in a threatened bacterium (Vibrio harveyi) in maricultured organisms. Vibrio harveyi is a gram-negative bacterium and a causal agent of vibriosis, a major disease in aquaculture farming industries (Sarjito et al., 2009). Studies have revealed V. harveyi as a frequently isolated Vibrio bacteria from cultured fish suffering from vibriosis in Southeast Asia (Tendencia and L.D.de la Peña, 2001; Ruangsri et al., 2004). The bacterium has been identified and reported as an opportunistic pathogen causing serious production losses in many aquaculture species of vertebrates and invertebrates, with varying mortalities from moderate to high in infected adult and juvenile populations respectively (Austin and Zhang, 2006; Nancy and Owens, 2013). This has caused significant loses to the economy of the industry worldwide.

 

Pathogenicity of V. harveyi relate to a number of factors including; secretion of extracellular products containing substances such as proteases, haemolysins and lipases, phospholipases, outermembrane proteins and adhesive factors to initiate virulence which successfully initiate and maintain disease (Austin and Zhang, 2006; Ningqiu et al., 2008, Cheng et al., 2010). VirB11, a type IV secretion system has been effectively studied in A. tumefaciens for transport of macromolecules such as proteins and DNA across cell envelope (Rego et al., 2010), however, VirB11 is not elucidated in Vibrio harveyi. Previous studies of VirB11 in A. tumefaciens showed that it is a member of a large family of ATPases associated with secretion systems of macromolecules (Planet PJ et al., 2000). VirB11 provides energy for substrate translocation (Atmakuri et al., 2004), and contributes to assembly of T-DNA transfer system (Sagulenko et al., 2001). VirB11-type ATPases function as chaperones to facilitate the movement of unfolded proteins and DNA substrates across the cytoplasmic membrane (Krause et al., 2000; Yeo et al., 2000). This analysis is aimed at a prospective vaccine with VirB11 against vibriosis. Molecular identification and characterization of VirB11 gene was achieved by computational predictions.

 

1 Materials and Methods

1.1 Strains and growth conditions

V. Harveyi strain HY99 used in this study was isolated from the liver of moribund marine fish E. coioides in Zhanjiang district of the Guangdong province of China and preserved in Guangdong provincial key laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals. Bacteria was selected on LB agar plates supplemented with 2% NaCl, cultured in LB broth supplemented with 2% NaCl, at 37°C for 8 hours, and preserved with 20% glycerol at -80°C. pMD18T (Amp+) plasmid was purchased from Takara Biotechnology (Dalian) Co. Ltd. DH5a competent cells were used as host for general cloning purposes.

 

1.2 PCR amplification of VIrB11 gene

Sense and antisense primers were designed based on VirB11 ORF for PCR amplification. PCR reaction was performed with rTaq DNA polymerase acquired from Takara LTD. PCR reaction consisted 25 ul DNA polymerase, 2 uM each forward and reverse primers, 2 ul DNA template and 19 ul sterile distilled water to make a total of 50 ml PCR mixture. Amplification was carried out at initial denaturation of 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 57°C for 30 seconds and extension at 72°C for 10 minutes. Amplified product was separated on 1% agarose by gel electrophoresis for 30 minutes at 110V, and visualized under Tanon 4100 Gel Logic Imaging System. Gels were sliced and purified with DNA Gel Extraction Kit from thermo scientific.

 

1.3 Transformation and selection of positive clones

DNA purification of target amplicon was ligated in to pMD 18T at a ratio of 1:3 vector to insert ratio and transformed in E. coli strain DH5α competent cells. The mixture was incubated on ice for 30 minutes, heat-shocked at 42°C for 45 seconds and returned to ice for 2 minutes. 800 ul LB broth was added and incubated at 37°C in a shaking incubator for 1 hour. Content was centrifuged at 12,000 r/min for 2 minute, 600 ul growth media discarded and bacteria suspended in remaining media for spread. Aliquot of transformed cells (100 ml each) was spread on LB agar plates with antibiotic (Amp+). Positive clones were identified by PCR amplification using universal primers M13 forward and reverse, and confirmed by sequencing at Sangon Biotechnology Co. (Shanghai, China).

 

1.4 Sequence analysis

Bioinformatics analysis of obtained results from sequencing was evaluated on NCBI employing nucleotide BLAST (Basic Local Alignment Tool) program (http://www.ncbi.nih.gov/BLAST) to determine identities and similarities to sequence of interest. EXPASY translate tool server (http://web.expasy.org/cgi-bin/translate/dna_aa) was used to translate nucleotide sequence into protein sequence. Isoelectric point (pI) and molecular weight (Mw) were predicted by EXPASY (http://web.expasy.org/compute_pI/Mw). Putative signal peptides were predicted by Signal Pv4.1 server (http://www.cbs.dtu.dk/services/SignalP) (Petersen et al., 2011) and transmembrane proteins by TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/transmembrane proteins). Conserved domain was found by NCBI conserved domain data base (CDD) (Marchler-Bauer et al., 2017). Protein sequences from NCBI Genbank database was used to construct phylogenetic tree and multiple sequence alignment.

 

2 Results

2.1 DNA cloning

Sense (ATGAACACCATCGATAAAGCTGC) and antisense (GCCCTCGCTTAACAGTCGATTC) primers were designed for PCR amplification of full length VirB11 (Figure 1)

 

 

Figure 1 PCR Amplification of VirB11 aided by 2,000 marker. M denotes marker, 1&2 VirB11 genes and-negative control

 

2.2 Sequence characterization of VirB11 genes

2.2.1 Physiochemical properties

 

Resulting gene sequence was submitted to GenBank under accession number MH545700. Sequence results showed full length of VirB11 encoded a nucleotide sequence of 1,034 bp coding 338 amino acids.

 

Physicochemical properties of V. harveyi VirB11 protein (Table 1) was analyzed using ExPASy (http://web. expasy.org/protparam/) software. The molecular structural formula of VirB11 was C1678H2668N460O494S16 with a total atom number of 5,316. VirB11 was shown to be a stable hydrophilic protein with a theoretical pI value of 6.31.

 

 

Table 1 Physicochemical properties of VirB11 protein

 

VirB11 protein subjected to signal peptide prediction using SignalP 4.1 Server showed no significant signal peptide cleavage sites. TMHMM Server 2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/) also showed VirB11 contained no transmembrane domain. PORST (https://psort.hgc.jp/) subcellular localization prediction showed VirB11 existence and abundance in the cytoplasm. Prediction by SoftBerry-Psite software (http://linux1.softberry.com/berry.phtml?topic=psite&group=programs&subgroup=proloc) revealed the amino acid sequence of VirB11 with four casein kinase II phosphorylation site, six protein kinase C phosphorylation, one N-glycosylation site, five N-myristoylation site, nine microbodies C-terminal targeting signal, one tyrosine kinase phosphorylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, one cell attachment sequence and one ATP/GTP-binding site motif A (P-loop) as shown in Figure 2.

 

 

Figure 2 VirB11 gene sequence and amino acid sequence

 

Casein kinase II phosphorylation site (aa: 202-205, 256-259, 263-266, 308-311), protein kinase C phosphorylation (aa: 110-112, 127-129, 152-154, 181-183, 228-230, 305-307), N-glycosylation site (aa: 54-57 ), N-myristoylation site (aa: 90-95, 177-182, 178-183, 180-185, 267-272), microbodies C-terminal targeting signal (aa: 64-66, 117-119, 128-130, 169-171, 216-218, 282-284, 319-321, 332-334), tyrosine kinase phosphorylation site (aa: 250-257), cAMP and cGMP-dependent protein kinase phosphorylation site (aa: 112-115), cell attachment sequence (aa: 250-252) and ATP/GTP-binding site motif A (P-loop) (aa: 177-184), * as terminator.

 

2.2.2 Homology analysis with similar protein sequences of Vibrio strains

VirB11 protein sequence of V. harveyi HY99 was subjected to homology comparison with Vibrio strains including V. campbellii and V. owensii through NCBI Blast (http://blast.ncbi.nlm.Gov/Blast.cgi). The results showed VirB11 protein was relatively stable in Vibrio.

 

Multiple alignment of deduced amino acid sequence of VirB11 from V. harveyi with close relatives retrieved from Genbank. Amino acid sequence abbreviations are as follows: The dark and grey shaded regions represent identical and similar region respectively and the unshaded portions indicated differences (Figure 3).

 

 

Figure 3 Multiple sequence alignment of VirB11

 

2.2.3 Phylogenetic analysis

Phylogenic tree of deduced amino acid sequence showed closeness of V. harveyi with Vibrio jasicida, V. owensii and V.campbellii (Figure 4).

 

 

Figure 4 Phylogenetic tree of HY99 VirB11 constructed by neighbour-joining method

 

2.2.4 Analysis of VirB11 structure domain

The putative conserved domains detected by NCBI conserved domain search program (http://ncbi.nlm.nih.gov/structure/cdd/wrpsb.cgi) showed VirB11 conserved with a P-loop NTPase domain (residues 60 to 942) shown in Figure 5. The results of VirB11 showed P-loopNTPase superfamily, AAA superfamily and RecA-like_NTPases superfamily. SOPMA secondary structure prediction (https://npsa-prabi. ibcp.fr/cgi-bin/secpred_sopma.pl) for VirB11 is shown in Figure 6. Tertiary structure prediction by SWISS-MODEL online software (http://swissmodel.expasy.org/) for a 3-D structure model showed VirB11 gene to be a Type IV secretion system protein in Figure 7 below.

 

 

Figure 5 Analysis of functional domain of VirB11 protein

 

 

Figure 6 Secondary structure of VirB11 protein in Vibrio harveyi

Note: Blue: α-helix; green: β-turn; red: stretch fragment; yellow: random coil

 

 

Figure 7 Three-dimensional structure of VirB11 protein in Vibrio harveyi HY99

 

3 Discussion

Secretion systems are used by many pathogens to deliver protein effectors to eukaryotic cells during the cause of infection (Green and Mecsas, 2016). In this bioinformatic study, VirB11 full length 1,034 bp coded 388 amino acids (aa). The predicted protein was weakly acidic with an isoelectric point of 6.31 and an estimated molecular weight of 37,703.39 Da. Signal P v4.1 server predicted no remarkable signal peptides showing VirB11 was not a secreted protein, no remarkable transmembranes were predicted. Casein kinase II phosphorylation site, protein kinase C phosphorylation, N-glycosylation site, N-myristoylation site, microbodies C-terminal targeting signal, tyrosine kinase phosphorylation site, cAMP and cGMP-dependent protein kinase phosphorylation site, cell attachment sequence and ATP/GTP-binding site motif A (P-loop) are indicated in Figure 2 above. Multiple alignment and phylogenic tree analysis of deduced amino acid sequence showed closeness of V. harveyi with Vibrio jasicida, V. owensii and V.campbellii.

 

Conserved domain database predicted a conserved P-loop NTPase domain between residues 60 to 942. P-loop NTPases are involved in cellular functions; members of the P-loop NTPase domain are characterized by a conserved nucleotide phosphate-binding motif thus Walker A motif involved in nucleotide binding and hydrolysis (Atmakuri et al., 2004). VirB11 uses NTP hydrolysis to provide energy for secretion or movement of macromolecules across membranes (Christie and Vogel, 2000; Christie, 2001). Walker A residues are required for binding phosphate groups (Yeo et al., 2000), and disrupt the capacity of C-terminal domain of VirB11 to self-assemble (Rashkova et al., 1997). AAA ATPases are energy-dependent unfoldases whose activities are associated with substrate remodeling (Christie, 2004). Secondary structure analysis of VirB11 presented α-helix, β-turn, stretch fragment and random coil. 3-D structure model showed VirB11 gene to be a Type IV secretion system protein.

 

4 Conclusion

VirB11 was cloned in V. harveyi and subjected to bioinformatics analysis to understand its function and candidacy for drugs against Vibrio bacteria pathogens. Studies reveal the potential of VirB11 for vaccine development to elicit protection against Vibrosis in maricultured organisms.

 

Authors’ contributions

DA carried out the cloning, molecular studies, analysis and drafted the manuscript. MES participated in the cloning of the gene. UFM participated in the molecular studies and performed the bioinformatics analysis. SC and HP conceived the study, and participated in its design, EDA and WL participated in its coordination. All authors read and approved the final manuscript.

 

Acknowledgments

Supported by Natural Science Foundation of Guangdong Province (2017A030307033;2017A030313174); Natural Science Foundation of Guangdong Ocean University (C17379); Undergraduate Innovative and Entrepreneurial Team Project (CCTD201802); Shenzhen modern agriculture and marine biological industry support plan project (2017042631005389); Science and Technology Program of Guangdong Province (2015A020209163).

 

References

Atmakuri K., Cascales E., and Christie P.J., 2004, Energetic components VirD4, VirB11 and VirB4 mediate early DNA transfer reactions required for bacterial type IV secretion, Molecular Microbiology, 54: 1199-1211

https://doi.org/10.1111/j.1365-2958.2004.04345.x

 

Austin B., and Zhang X.H., 2006, Vibrio harveyi: a significant pathogen of marine vertebrates and invertebrates, Letters in Applied Microbiology, 43: 119-124

https://doi.org/10.1111/j.1472-765X.2006.01989.x

 

Cheng S., Zhang W.W., Zhang M., and Sun L., 2010, Evaluation of the vaccine potential of a cytotoxic protease and a protective immunogen from a pathogenic V, harveyistrain, Vaccine, 28(4): 1041-1047

https://doi.org/10.1016/j.vaccine.2009.10.122

 

Christie P.J., 2001, Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines, Molecular Microbiology, 40: 294-305

https://doi.org/10.1046/j.1365-2958.2001.02302.x

 

Christie P.J., and Vogel J.P., 2000, Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells, Trends in Microbiology, 8: 354-360

https://doi.org/10.1016/S0966-842X(00)01792-3

 

Cheng W., and Chen J.C., 2000, Effects of pH, temperature and salinity on immune parameters of the freshwater prawn Macrobrachiumrosenbergii, Fish Shellfish Immunology, 10: 387-391

https://doi.org/10.1006/fsim.2000.0264

 

FAO, 2009, The state of world fisheries and aquaculture, FAO Fisheries and Aquaculture Department(ed), Rome: Food and Agriculture Organization of the United Nations, 178

 

FAO, 2014, World Review of Fisheries and Aquaculture Topic: Status and Trends, In: The State of World Fisheries and Aquaculture, 2014: Opportunities and challenges, Rome, pp.223

 

Green E.R., and Mecsas J., 2016, Bacterial Secretion Systems-An overview, Microbiology Spectrum, 4(1)

 

Krause S.M., Barcena W., Panseqrau R., Lurz J., Carazo, and Lanka E., 2000, Sequence related protein export NTPases encoded by the conjugative transfer region of RP4 and by the cag pathogenicity island of Helicobacter pylori share similar hexameric ring structures, Proceedings of National Academy of Sciences, USA, 97: 3067-3072

https://doi.org/10.1073/pnas.97.7.3067

 

Martínez Cruz P., Ibáñez A.L., Hermosillo O.A.M., and Ramírez Saad H.C., 2012, Use of Probiotics in Aquaculture, ISRN Microbiology, Article ID 916845, 13 pages

 

Nancy B.S., and Owens L., 2013, Virulence changes to Harveyiclade bacteria infected with bacteriophage from Vibrio owensii, Indian Journal of Virology, 24(2): 180-187

https://doi.org/10.1007/s13337-013-0136-1

 

Ningqiu L., Junjie B., Shuqin W., Xiaozhe F., Haihua L., Xing Y., and Cunbin S., 2008, An outer membrane protein, OmpK, is an effective vaccine candidate for Vibrio harveyi in Orange-spotted grouper (Epinepheluscoioides), Fish Shellfish Immunology, 25: 829-833

https://doi.org/10.1016/j.fsi.2008.09.007

 

Peter J., and Christie, 2004, Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems, Biochimicaet Biophysica Acta, 1694: 219-234

 

Petersen T.N., Brunak S., Von-Heijne G., and Nielsen H., 2011, SignalP 4.0: Discriminating signal peptides from transmembrane regions, Nature Methods, 8(10): 785-786

https://doi.org/10.1038/nmeth.1701

 

Planet P.J., Kachlany S.C., DeSalle R., and Figurski D.H., 2001, Phylogeny of genes for secretion NTPases: identification of the widespread tadA subfamily and development of a diagnostic key for gene classification, Proceedings of National Academy of Sciences, USA, 98: 2503-2508

https://doi.org/10.1073/pnas.051436598

 

Rashkova S., Spudich G.M., and Christie P.J., 1997, Mutational analysis of the Agrobacterium tumefaciens VirB11 ATPase: identification of functional domains and evidence for multimerization, Journal of Bacteriology, 179: 583-589

https://doi.org/10.1128/jb.179.3.583-591.1997

 

Rêgo M.M.T., Neiva J.N.M., Rêgo A.C., Cândido M.J.D., Alves A.A., and Lôbo R.N.B., 2010, Intake, nutrients digestibility and nitrogen balance of elephant grass silages with mango by-product addition, RevistaBrasileira de Zootecnia, 39 (1): 74-80

https://doi.org/10.1590/S1516-35982010000100010

 

Ruangsri J., Wannades M., Wanlem S., Songnui S., Arunrat N., Tanmark N., Pecharat T., and Supamattaya K., 2004, Pathogenesis and virulence of Vibrio harveyi from southern part of Thailand in black tiger shrimp, Penaeusmonodon Fabricius, Songklanakarin Journal of Science and Technology, 26: 43-45

 

Sarjito, Radjasa O.K., Sabdono A., Prayitno S.B., and Hutabarat S., 2009, Phylogenetic diversity of the causative agents of Vibriosis associated with groupers fish from Karimunjawa Islands, Indonesia, Current Research in Bacteriology, 2(1): 14-21

https://doi.org/10.3923/crb.2009.14.21

 

Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S., 2013, MEGA6: Molecular Evolutionary Genetics Analysis version 6.0., Molecular Biology and Evolution, 30(12): 2725-2729

https://doi.org/10.1093/molbev/mst197

 

Tendencia E.A., and L.D. de la Peña, 2001, Antibiotic resistance of bacteria from shrimp ponds, Aquaculture, 195: 193-204

https://doi.org/10.1016/S0044-8486(00)00570-6

 

Yeo H.J., Savvides S.N., Herr A.B., Lanka E., and Waksman G., 2000, Crystal structure of the hexameric traffic ATPase of the Helicobacter pylori type IV system, Molecule Cell, 6: 1461-1472

https://doi.org/10.1016/S1097-2765(00)00142-8

Genomics and Applied Biology
• Volume 9
View Options
. PDF(0KB)
. HTML
Associated material
. Readers' comments
Other articles by authors
. Denicia  Atujona
. Weijian  Liang
. Shuanghu  Cai
. huanying pang
. Umar Faruk  Mustapha
. Michael Essien  Sekyi
. Emmanuel. D.  Abarike
Related articles
. Vibrio harveyi
. VirB11
. Bioinformatic analysis
Tools
. Email to a friend
. Post a comment