Research Report

Expression and Purification of Arabidopsis CASPL1D2 Protein  

Yujie Qu1,2 , Shenkui Liu3 , Yuanyuan Bu1,2
1 Key Laboratory of Saline-Alkali Vegetation Ecology Restoration (Northeast Forestry University), Ministry of Education, Harbin, 150040, China
2 College of Life Science, Northeast Forestry University, Harbin 150040, China
3 The State Key Laboratory of Subtropical Silviculture, Zhejiang Agriculture and Forestry University, Lin’An, 311300, China
Author    Correspondence author
Molecular Soil Biology, 2023, Vol. 14, No. 2   doi: 10.5376/msb.2023.14.0002
Received: 18 Jan., 2023    Accepted: 08 Apr., 2023    Published: 16 May, 2023
© 2023 BioPublisher Publishing Platform
This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article:

Qu Y.J., Liu S.K., and Bu Y.Y., 2023, Expression and purification of Arabidopsis CASPL1D2 protein, Molecular Soil Biology, 14(2): 1-5 (doi: 10.5376/msb.2023.14.0002)

Abstract

AtCASPL1D2 belongs to the non-featured protein family UPF0497. To investigate the optimal conditions for its protein expression and purification, the AtCASPL1D2 gene from wild-type Arabidopsis thaliana was cloned and constructed into the protein expression vector pET-32a. The AtCASPL1D2 gene was expressed in Escherichia coli BL21 as a His fusion protein. The His-AtCASPL1D2 fusion protein was induced and purified under the optimized culturing condition of 0.2 mM IPTG and 20 ℃ for 5 h. The study laid the foundation for subsequent experiments to analyze the activity of AtCASPL1D2 protein and to verify the interaction between the gene and the proteins.

Keywords
AtCASPL1D2; Protein expression; Protein purification; Arabidopsis thaliana

Abiotic stress is a major environmental factor that adversely affects plant growth, development and yield, and plants have evolved complex signaling networks to adapt to abiotic stress by regulating various physiological and biochemical processes (Bohnert et al., 1995; Xiong et al., 2002). Plant cell barriers have an independent evolutionary origin. The root endothelium is very similar to the polarized epithelium and has nutrient uptake and stress tolerance functions (Diet et al., 2006). The kaiju band membrane structural domain protein (CASP), a key protein for kaiju band formation in the plant endothelium, belongs to the Arabidopsis “non-characteristic protein family” UPF 0497 (39 members) and shows high stability in its membrane structural domain (Roppolo et al., 2011; Roppolo et al., 2014).

 

The kaiju band membrane structural domain protein classes (CASPs) are a class of four transmembrane proteins that mediate kaiju band deposition in the endothelium through a recruitment lignin polymerization mechanism, and these CASPs are thought to form an extensive transmembrane polymer platform and are hypothesized to direct the assembly and activity of lignin biosynthetic enzymes (Roppolo et al., 2014). More recently, evolutionary analysis of CASP family genes has shown that CASPL genes belong to the MARVEL (MAL and related proteins for vesicle transport and membrane attachment) protein family, which has so far only been described experimentally in postnatal animals (Yang et al., 2015; Maurel et al., 2021). CASP-like related proteins are expressed throughout the plant, and four of them (CASPL1B1, CASPL1B2, CASPL1D1 and CASPL1D2) were identified to interact with AtPIP2 (Champeyroux et al., 2019). The Arabidopsis gene AtCASPL1D2 belongs to UPF0497 and its protein function has not been studied, and its protein was induced and purified in order to study its protein properties (Shibuya et al., 2009; Deihimi et al., 2012).

 

In this study, the AtCASPL1D2 gene of size 600 bp was isolated from Arabidopsis thaliana from DNA and cloned into the protein expression vector pET-32a to construct the pET-32a-AtCASPL1D2 plasmid. The AtCASPL1D2 gene was expressed as His fusion protein in E. coli BL 21 under different IPTG concentrations, induction temperatures and induction times, and the His-AtCASPL1D2 fusion protein was purified under optimized conditions.

 

1 Materials and Methods

1.1 Main materials

The wild-type Arabidopsis thaliana in Colombia was used as the experimental material, and the Arabidopsis thaliana used in the experiments were all from the laboratory of Northeast Forestry University.

 

1.2 Reagents

Plant RNA Extraction Kit (TAKARA), EX-Taq DNA Polymerase (TAKARA), Reverse Transcription Kit (TAKARA), pMD18-T (TAKARA), Gum Recovery Kit (Kangwei Century), Plasmid Small Lift Kit (Kangwei Century), E. coli DH5α (Kangwei Century), Two-color Pre-stained Protein Molecular Weight Marker (Epizyme), Isopropyl-β-D-Thiogalactopyranoside (IPTG), pET-32a vector, BL21 strain are from Lab 338, Northeast Forestry University.

 

1.3 Instruments

PCR thermal cycler (ABI 9700), ultra clean bench (Boxun), autoclave (Boxun), thermostatic shaker IS-RDV3 (CRYSTA), gel imaging system (Tanon 1600).

 

1.4 Cloning of AtCASPL1D2 gene

Arabidopsis total RNA was extracted using the Trizol method, reverse transcribed into cDNA, and this cDNA was used as a template to amplify the full-length cDNA sequence of AtCASPL1D2 by polymerase chain reaction (PCR) using AtCASPL1D2-specific primers (At3G06390-F: ATGGCGTCTACTGAGAACCC. At3G06390-R: TCATGTTCTCTTGGAGAGTGCT; 600 bp, At3g06390), recovered the target fragment ligated to pMD18-T, transformed E. coli DH5α, screened in LB solid medium containing 50 μg/mL aminobenzylpenicillin, picked a single clone for PCR identification, and extracted the plasmid to send to the company Sequencing (Jin Wei Zhi).

 

1.5 Construction and characterization of prokaryotic expression vectors

A pair of primers with restriction endonuclease was designed at both ends of the gene (pET-32a-At3G06390-F: GGTACCATGGCGTCTACTGAGAACCC, KpnⅠunderlined; pET-32a-At3G06390-R: AAGCTTTCATGTTCTCTCTTGGAGAGTGCT, Hind Ⅲ underlined), after successful vector construction, the plasmid and pET-32a plasmid were extracted and ligated with KpnⅠ and HindⅢ, respectively, and the T4 linker was ligated overnight at 22 °C and transformed into protein expression strain BL21, and a single clone was picked for PCR identification to obtain the successfully identified His-AtCASPL1D2 strain.

 

1.6 Optimization of conditions for His-AtCASPL1D2 fusion protein expression

His-AtCASPL1D2 bacterial broth was cultured in LB medium, and His-AtCASPL1D2 fusion protein expression was induced with isopropyl β-D-thiogalactoside (IPTG) to detect His-AtCASPL1D2 protein at different IPTG (0.2, 0.5, 1 and 2 mmol/L), time (1, 2, 3, 4 and 5 h) and temperature (20, 25, 30 and 37 °C) for induction of expression. After the induction of expression, the organisms were collected and resuspended in PBS, and 20 μL of samples were added to 20 μL of 5×SDS loading buffer (100 mmol/L Tris-HCl pH 6.8, 200 mmol/L DTT, 4% sodium dodecyl sulfate, 2% bromophenol blue, 20% glycerol), boiling water bath for 10 min, and centrifuged at 4 °C, 13 000 rpm for 1 min. 20 μL of supernatant was taken for SDS- PAGE gel electrophoresis (Yuan et al., 2017).

 

1.7 Mass induction and purification of His-AtCASPL1D2 protein

In order to obtain a large amount of His-AtCASPL1D2 fusion protein, 2 mL of overnight shake was added to 200 mL LB liquid medium and incubated at 37 °C for 3 h with an OD600 of about 0.8, 0.2 mmol/LIPTG was added and induced at 20 °C for 4 h, the organism was collected, an appropriate amount of PBS buffer was added, ultrasonication was performed to break it up, and then the supernatant and The precipitates were then taken separately for SDS- PAGE gel electrophoresis.

 

Wash the precipitate with inclusion buffer, centrifuge at 15 200 rcf, 4 °C, 15 min and discard the supernatant; lyse the inclusion body with 8M urea and 10 mm Tris-HCl (pH=7.4) at room temperature, centrifuge at 15 200 rcf, 4 °C, 40 min and take the supernatant; add BindingBuffer and sonicate for 20 min, 13 000 rpm Centrifuge the supernatant at room temperature for 30 min, and the recombinant protein will be recovered.

 

Add 200 μL of Ni-NTA purification resin to the purification column followed by 400 μL of PBS equilibration solution, mix well and filter out; add the protein supernatant obtained after bulk induction and the protein supernatant after inclusion body renaturation to the purification column, mix well, let stand on ice for 15 min and filter out the heteroproteins. Add 2 mL of protein wash buffer, mix well, let stand on ice for 5 min, and elute with 20, 200, 350, and 500 mmol/L imidazole, and save the filtrate as purified protein (Qu, 2019).

 

2 Results and Analysis

2.1 Cloning of AtCASPL1D2 gene

The size of AtCASPL1D2 gene amplification is about 600 bp (Figure 1). PCR product was recovered and ligated to pMD18-T for sequencing (Jin Wei Zhi), and the sequencing result was correct.

 


Figure 1 Amplification of AtCASPL1D2 gene

Note: M: 2000 marker; 1: AtCASPL1D2 gene

 

2.2 Construction and characterization of His-AtCASPL1D2 vector

According to the sequencing results, the gene size is 600 bp, and the bands of the gene and vector can be clearly seen at the correct position after the enzymatic digestion of AtCASPL1D2-T and pET-32a plasmid with KpnⅠ and HindⅢ (Figure 2), which indicates that AtCASPL1D2 is successfully ligated with pET-32a and the sequencing results are correct.

 


Figure 2 pET-32a-AtCASPL1D2 double digestion identification

Note: M: 5000 marker; 1, 2, 3: pET-32a-AtCASPL1D2 double digestion identification

 

2.3 Optimization of induction conditions of recombinant protein His-AtCASPL1D2

To determine the expression of His-AtCASPL1D2, the pET-32a-AtCASPL1D2 plasmid-transformed E. coli BL21 monoclonal was firstly picked and shaken overnight, 200 μL of bacterial solution was added to 800 μL LB liquid medium, activated for 3 h, the value of OD600 was about 0.8, and 0.2, 0.5, 1 and 2 mmol/L of IPTG induction, keep the temperature constant at 20 °C, change the IPTG induction time, and collect the bacterium after 0, 3 and 5 h induction respectively, the results showed that the expression of AtCASPL1D2 increased with time, and the protein expression reached the maximum at 5 h, and the protein expression reached the maximum at 0.2 mmol/L IPTG induction, and with the increase of IPTG concentration, the protein expression did not increase(Figure 3A).

 


Figure 3 Expression of His-AtCASPL1D2 fusion protein at 20 °C (A) and 25 °C (B) for 0, 3 and 5 h, respectively

Note: A: M: protein marker, 1, 2, 3, 4, 5 for 0 h, IPTG concentrations of 0, 0.2, 0.5, 1, 2 mmol/L; 6, 7, 8, 9, 10 for 3 h, IPTG concentrations of 0, 0.2, 0.5, 1, 2; 11, 12, 13, 14, 15 for 5 h, IPTG concentrations of 0, 0.2, 0.5, 1, 2 mmol/L. B: M: protein marker, 1 for 0 h, 0 mmol/L IPTG, 2, 3, 4, 5, 6 for 3 h, IPTG concentrations of 0, 0.2, 0.5, 1, 2 mmol/L; 7, 8, 9, 10, 11 for 5 h, IPTG concentrations of 0, 0.2, 0.5, 1, 2 mmol/L

 

The induction time of IPTG was kept at 5 h and the concentration of IPTG was kept constant at 0.2 mmol/L. The induction temperatures were changed to 20, 25, 28, 30 and 37 °C. After induction, the bacteriophages were collected and the results showed that AtCASPL1D2 was expressed at a higher level at 20 °C (Figure 3B).

 

2.4 Extraction and purification of inclusion body proteins

Bulk induction was performed at 20 °C with IPTG concentration of 0.2 mmol/L for 5 h. The induced bacterial broth was resuspended with PBS and ultrasonically crushed, and the supernatant and precipitate were taken separately for SDS-PAGE gel electrophoresis, and the recombinant protein was found to be expressed in both supernatant and precipitate (Figure 4A). After denaturing and denaturing the protein from the precipitate, the supernatant protein was purified with the denaturing protein by affinity chromatography resin, and the purified protein was subjected to SDS-PAGE gel electrophoresis, and the results showed that the target protein was successfully purified and the best purification was achieved with 200 mmol/L imidazole (Figure 4B).

 


Figure 4 A: Massive induction of His-AtCASPL1D2 protein, B: Effect of different concentrations of imidazole on the elution of His-AtCASPL1D2 fusion protein

Note: A: M: protein marker, 1 is His supernatant protein, 2 is His precipitated protein, 3 is His-AtCASPL1D2 supernatant protein, 4 is His-CASPL1D2 precipitated protein; B: M: protein marker, 1, 2, 3, 4 are His-AtCASPL1D2 supernatant protein eluted with 20, 200, 350 and 500 mmol/L imidazole elution, 5, 6, 7, 8 are His-AtCASPL1D2 precipitated proteins eluted with 20, 200, 350 and 500 mmol/L imidazole, respectively

 

3 Discussion

Recombinant expression and purification of proteins is key to biochemical and biophysical research. Although this has become a routine and standard procedure for many proteins, intrinsically disordered proteins and those with low complexity sequences pose difficulties (Dhakal et al., 2020). Whether exogenous genes can be properly expressed in E. coli receives many factors (Paik and Huq, 2019). The induced expression and purification of AtCASPL1D2 protein was performed in vitro and a large number of target proteins were obtained. The effects of different induction times, induction temperatures and IPTG concentrations on protein expression were investigated, and it was concluded that the maximum expression of AtCASPL1D2 protein was achieved at an IPTG induction concentration of 0.2 mmol/L, an induction temperature of 20 °C and an induction time of 5 h. By analyzing the expression of the supernatant and precipitate of the protein, the induced protein was expressed in both supernatant and precipitate, and the target protein in the inclusion bodies was extracted with urea, and the final His- AtCASPL1D2 fusion protein was obtained by purification using affinity chromatography resin, but the protein size was about 10 kDa smaller than the predicted 36 kDa, presumably because it was difficult to induce expression of the membrane protein or the protein was not fully expression. The successful purification of the target protein provided a basis for downstream validation experiments.

 

Authors’ contributions

QYJ and BYY designed the study. QYJ performed the experiments and drafted the manuscript. BYY and LSK supervised the study and critically revised the manuscript.

 

Acknowledgments

This work was jointly supported by Heilongjiang Province Government Postdoctoral Science Foundation (LBH-Q18008) awarded to Yuanyuan Bu and the Program for Changjiang Scholars and Innovative Research Team in University (No. IRT17R99) awarded to Shenkui Liu. The funders had no role in study design.

 

References

Bohnert H.J., Nelson D.E., and Jensen R.G., 1995, Adaptations to environmental stresses, The Plant Cell, 7(7): 1099-1111.

https://doi.org/10.1105/tpc.7.7.1099

 

Champeyroux C., Bellati J., Barberon M., Rofidal V., Maurel C., and Santoni V., 2019, Regulation of a plant aquaporin by a Casparian strip membrane domain protein-like, Plant Cell and Environment, 42(6): 1788-1801.

https://doi.org/10.1111/pce.13537

 

Deihimi T., Niazi A., Ebrahimi M., Kajbaf K., Fanaee S., Bakhtiarizadeh M.R., and Ebrahimie E., 2012, Finding the undiscovered roles of genes: an approach using mutual ranking of coexpressed genes and promoter architecture-case study: dual roles of thaumatin like proteins in biotic and abiotic stresses, Springerplus, 1: 30.

https://doi.org/10.1186/2193-1801-1-30

 

Dhakal S., Sapkota K., Huang F., and Rangachari V., 2020, Cloning, expression and purification of the low-complexity region of RanBP9 protein, Protein Expression and Purification, 172: 105630.

https://doi.org/10.1016/j.pep.2020.105630

 

Diet A., Link B., Seifert G.J., Schellenberg B., Wagner U., Pauly M., Reiter W.D., and Ringli C., 2006, The Arabidopsis root hair cell wall formation mutant lrx1 is suppressed by mutations in the RHM1 gene encoding a UDP-L-rhamnose synthase, Plant Cell, 18(7): 1630-1641.

https://doi.org/10.1105/tpc.105.038653

 

Maurel C., Tournaire-Roux C., Verdoucq L., and Santoni V., 2021, Hormonal and environmental signaling pathways target membrane water transport, Plant Physiol, 187(4): 2056-2070.

https://doi.org/10.1093/plphys/kiab373

 

Paik I., and Huq E., 2019, Plant photoreceptors: Multi-functional sensory proteins and their signaling networks, Seminars in Cell and Developmental Biology, 92: 114-121.

https://doi.org/10.1016/j.semcdb.2019.03.007

 

Qu L.D., 2019, Cloning, expression, purification and enzymatic properties of AsSK, AtFMN and AtFMN, Thesis for M.S., Huazhong Normal University, Supervisor: Li W.G., pp30-34.

 

Roppolo D., De Rybel B., Tendon V.D., Pfister A., Alassimone J., Vermeer J.E.M., Yamazaki M., Stierhof Y.D., Beeckman T., and Geldner N., 2011, A novel protein family mediates Casparian strip formation in the endodermis, Nature, 473(7347): 380-383.

https://doi.org/10.1038/nature10070

 

Roppolo D., Boeckmann B., Pfister A., Boutet E., Rubio M.C., Denervaud Tendon V., Vermeer J.E.M., Gheyselinck J., Xenarios I., and Geldner N., 2014, Functional and Evolutionary Analysis of the CASPARIAN STRIP MEMBRANE DOMAIN PROTEIN Family, Plant Physiol, 165(4): 1709-1722.

https://doi.org/10.1104/pp.114.239137

 

Shibuya K., Yamada T., Suzuki T., Shimizu K., and Ichimura K., 2009, InPSR26, a Putative Membrane Protein, Regulates Programmed Cell Death during Petal Senescence in Japanese Morning Glory, Plant Physiol, 149(2): 816-824.

https://doi.org/10.1104/pp.108.127415

 

Xiong L., Schumaker K.S., and Zhu J.K., 2002, Cell signaling during cold, drought, and salt stress, Plant Cell, 14(Suppl): S165-183.

https://doi.org/10.1105/tpc.000596

 

Yang J., Ding C., Xu B., Chen C., Narsai R., Whelan J., Hu Z., and Zhang, M., 2015, A Casparian strip domain-like gene, CASPL, negatively alters growth and cold tolerance, Scientific Reports, 5: 14299.

https://doi.org/10.1038/srep14299

 

Yuan M., Zhang L., Wang L., Ge W.N., and Xing J.H., 2017, Protein expression and purification of the flowering repressor gene TFL1 in Arabidopsis thaliana, Journal of Hebei Agricultural University 40(1): 15-20.

Molecular Soil Biology
• Volume 14
View Options
. PDF(0KB)
. HTML
Associated material
. Readers' comments
Other articles by authors
. Yujie Qu
. Shenkui Liu
. Yuanyuan Bu
Related articles
. AtCASPL1D2
. Protein expression
. Protein purification
. Arabidopsis thaliana
Tools
. Email to a friend
. Post a comment